Sequence ID | >WENV170784212 |
Genome ID | MCHG01000126 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 18441 |
End posion on genome | 18512 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
gttgcagttc |
tRNA gene sequence |
GCGTTGATGGTCTAGTGGCTATGACTTGGGCCTTCCAAGCCCAAAACCCGGGTTCGAATC |
Downstream region at tRNA end position |
aataatgaaa |
Secondary structure (Cloverleaf model) | >WENV170784212 Gly TCC c Atta aataatgaaa G - C C - G G - C T + G T + G G - C A - T T A T G G C C C A T G A G | | | | | G G T C T G C C G G G C G | | | T T C T G A C T A T AAAC T - A G - C G - C G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |