Sequence ID | >WENV170784226 |
Genome ID | MCHG01000166 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 631 |
End posion on genome | 559 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
cttctcaagt |
tRNA gene sequence |
GCCGTCGTGGCTTAGCGGTATAGCGGCTGATTCGTAATCAGCAGGCCGAGGGTTCAAGTC |
Downstream region at tRNA end position |
gtttatttag |
Secondary structure (Cloverleaf model) | >WENV170784226 Thr CGT t TCtc gtttatttag G - C C - G C - G G - C T + G C - G G - C T G T C T C C C A G A G | | | | | A C T T C G G A G G G C G | | | T T G T A G C T A G AGGCC G - C C - G T - A G - C A - T T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |