Sequence ID | >WENV170784227 |
Genome ID | MCHG01000167 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 29392 |
End posion on genome | 29478 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
tacgctttgT |
tRNA gene sequence |
GCCGAGGTAGTCTAGTGGTAGGGCGCAAGCCTGGAAAGCTTGTGGGGCTTAGCCCCTCGG |
Downstream region at tRNA end position |
gacttttctt |
Secondary structure (Cloverleaf model) | >WENV170784227 Ser GGA T GTCA gacttttctt G - C C - G C - G G - C A - T G - C G - C T A T C C C T C A G A A | | | | | G T T C T G G G G A G C G + | + | T T G G G G C T A G TGGGGCTTAGCCCCTC C - G A - T A - T G - C C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |