Sequence ID | >WENV170784230 |
Genome ID | MCHG01000176 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 12254 |
End posion on genome | 12181 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
agatcgaagt |
tRNA gene sequence |
GTCCGGATAGTGTAGAGGCCTATCATGGAGCCCTGTCGAGGCTCCGACTCGGGTTCGAAT |
Downstream region at tRNA end position |
tattttttct |
Secondary structure (Cloverleaf model) | >WENV170784230 Asp GTC t GCtt tattttttct G - C T + G C - G C - G G - C G - C A - T T A T G G C C C A A G A A + | | | | G G T G T G T C G G G C G | | + T T C T C A T C T A G CGAC G - C A - T G - C C - G C - G C A T G G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |