Sequence ID | >WENV170784243 |
Genome ID | MCHG01000208 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 19909 |
End posion on genome | 19832 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
cctgctccgc |
tRNA gene sequence |
GGGGCCGTAGGGTAGCTTGGTCCATCCTGCAAGACTGGGGGTCTTGCGACTTGAGTTCGA |
Downstream region at tRNA end position |
aaattcatag |
Secondary structure (Cloverleaf model) | >WENV170784243 Pro GGG c ACCA aaattcatag G - C G - C G - C G - C C - G C - G G - C T A T A A C T C A T C G A A | | | | | G T T G G G T T G A G C G | | + T T G T C C T T C C A G CGAC C - G A - T A - T G - C A - T C G T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |