Sequence ID | >WENV170784244 |
Genome ID | MCHG01000218 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 511 |
End posion on genome | 586 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
acagcataaT |
tRNA gene sequence |
GGGCTCGTGGTCTAGTCGGTCATGACATCGCCTTTACACGGCGGGGATCCTGAGTTCGAA |
Downstream region at tRNA end position |
cttcttttct |
Secondary structure (Cloverleaf model) | >WENV170784244 Val TAC T ATtc cttcttttct G - C G - C G - C C - G T + G C - G G - C T A T G A C T C A T G A G | | | | | G C T C T G C T G A G C G | | | T T G T G A C T C A A GGATC T + G C - G G - C C - G C - G T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |