Sequence ID | >WENV170784246 |
Genome ID | MCHG01000221 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 4551 |
End posion on genome | 4627 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
ccttcatttc |
tRNA gene sequence |
GGGCCCGTAGCTTAGCCTGGTGGAGCGCACGGCTGATAACCGTGAGGTCCTGCGTTCGAA |
Downstream region at tRNA end position |
tattttcttt |
Secondary structure (Cloverleaf model) | >WENV170784246 Ile GAT c ACCA tattttcttt G - C G - C G - C C - G C - G C - G G - C T A T G A C G C A C G A A | | | | | G C T T C G C T G C G C T + | | | T T G G A G C G T G G AGGTC C - G A - T C - G G - C G - C C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |