Sequence ID | >WENV170784252 |
Genome ID | MCHG01000235 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 10015 |
End posion on genome | 9941 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
gaaacaataa |
tRNA gene sequence |
GGGCCTGTAGCTCAGTCAGGTTAGAGCGCTCGGCTCATAACCGAGCGGTCACCGGTTCAA |
Downstream region at tRNA end position |
actttatatc |
Secondary structure (Cloverleaf model) | >WENV170784252 Met CAT a Ataa actttatatc G - C G - C G - C C - G C - G T - A G - C T A T T G G C C A C T G A A | | | | | A A C T C G A C C G G C G | | | | T T G G A G C T T A G CGGTC C - G T - A C - G G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |