Sequence ID | >WENV170784263 |
Genome ID | MCHG01000296 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 10918 |
End posion on genome | 10992 |
Amino Acid | Ala |
Anticodon | CGC |
Upstream region at tRNA start position |
tttcttaaaa |
tRNA gene sequence |
GGGCTCGTAGATCAGGGGTAGATCGTTACGTTCGCAACGTAAAGGCCGCGGGTTCAAATC |
Downstream region at tRNA end position |
agaaatttaa |
Secondary structure (Cloverleaf model) | >WENV170784263 Ala CGC a ACTA agaaatttaa G - C G - C G + T C - G T - A C - G G - C T A T C G C C C A G A A | | | | | A G C T A G G C G G G C G | | | | T T G G A T C T A G AGGCC T - A T - A A - T C - G G - C T A T A C G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |