Sequence ID | >WENV170784270 |
Genome ID | MCHG01000314 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 3716 |
End posion on genome | 3789 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
acgccgatac |
tRNA gene sequence |
GCGGATGTAGTTCAATGGTAGAACTTCAGCTTCCCAAGCTGATAGCGCGGGTTCGATTCC |
Downstream region at tRNA end position |
ctgatgccgg |
Secondary structure (Cloverleaf model) | >WENV170784270 Gly CCC c TCAA ctgatgccgg G - C C - G G - C G - C A - T T - A G - C T T T T G C C C A A A A + | | | | G T C T T G G C G G G C G | | | | T T G G A A C T A T TAGC T - A C - G A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |