Sequence ID | >WENV170784275 |
Genome ID | MCHG01000341 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 258 |
End posion on genome | 187 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
ccaacttcga |
tRNA gene sequence |
ACATCAGTAGTGTAGCGGTCATCACCGGGCGTTGCCAACGCTCGAACCCGGGTTCGAATC |
Downstream region at tRNA end position |
tcttttgaaa |
Secondary structure (Cloverleaf model) | >WENV170784275 Gly GCC a Atat tcttttgaaa A - T C - G A - T T - A C - G A - T G - C T A T G G C C C A C G A A | | | | | G G T G T G C C G G G C G | | | T T T T C A C C A C GAAC G - C G + T G - C C - G G - C T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |