Sequence ID | >WENV170784285 |
Genome ID | MCHG01000414 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 3060 |
End posion on genome | 3136 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tcaacccttT |
tRNA gene sequence |
AGCGGGGTGGGGTAGCCAGGAGATCCCGACGGGCTCATAACCCGTAGACCGATGGTTCGA |
Downstream region at tRNA end position |
aaagtttttt |
Secondary structure (Cloverleaf model) | >WENV170784285 Met CAT T ATga aaagtttttt A - T G - C C - G G - C G - C G - C G - C T A T C T A C C A C C G A G | | | | | G A T G G G G A T G G C G | | | T T G T C C C A G A G AGACC A - T C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |