Sequence ID | >WENV170784294 |
Genome ID | MCHG01000494 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 1359 |
End posion on genome | 1431 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
tttaacgtgc |
tRNA gene sequence |
AGTCCTGTAGGGTAGTGGTCAATCCTTCGGGCCTTTGGAGCCCGGGACAGCGGTTCGAAT |
Downstream region at tRNA end position |
aaatattttt |
Secondary structure (Cloverleaf model) | >WENV170784294 Gln TTG c Ataa aaatattttt A - T G - C T - A C - G C - G T - A G - C T A T T C G C C A T G A A | | | | | G G T G G G A G C G G C G | | + T T T T C C T C A A T GGAC C - G G - C G - C G - C C - G C A T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |