Sequence ID | >WENV170784300 |
Genome ID | MCHG01000572 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 7926 |
End posion on genome | 8000 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
cacgggccat |
tRNA gene sequence |
CGGGGTATGGCGCAGCTTGGTAGCGCGCGTCGTTCGGGACGACGAGGTCGCAGGTTCAAA |
Downstream region at tRNA end position |
cagcacagaa |
Secondary structure (Cloverleaf model) | >WENV170784300 Pro CGG t ACag cagcacagaa C - G G - C G - C G - C G - C T - A A - T T A T T G T C C A C G A G + | | | | A T C G C G G C A G G C T | | | | T T G G C G C G T A G AGGTC C - G G - C T - A C - G G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |