Sequence ID | >WENV170784301 |
Genome ID | MCHG01000637 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 4541 |
End posion on genome | 4456 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
tcaacaaagg |
tRNA gene sequence |
GCGAGAGTAACCAAGCGGTCAACGGTGAACGACTCAAGATCGTTTCGCGCAGGCGTTCAA |
Downstream region at tRNA end position |
atttttttac |
Secondary structure (Cloverleaf model) | >WENV170784301 Leu CAA g ACTA atttttttac G - C C - G G - C A - T G - C A - T G - C T A T T T C C C A C G A A | | | | | A G A C C A A A G G G C G | | | T T T C G G T C A A G TCGCGCAGGCGTTC A - T A - T C - G G - C A - T C A T G C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |