Sequence ID | >WENV170784302 |
Genome ID | MCHG01000657 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 6245 |
End posion on genome | 6320 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
ccgaaagcat |
tRNA gene sequence |
GCACCTCTAGCTCAATTGGCAGAGCAACTGACTCTTAATCAGTGGGTTCCCGGTTCAAGT |
Downstream region at tRNA end position |
cagcaccaca |
Secondary structure (Cloverleaf model) | >WENV170784302 Lys CTT t ACCA cagcaccaca G - C C - G A - T C - G C - G T + G C - G T G T G G G C C A T A A A | | | | | A T C T C G C C C G G C G | | | | T T G G A G C C A A GGGTT A - T C - G T - A G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |