Sequence ID | >WENV170784303 |
Genome ID | MCHG01000661 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 3866 |
End posion on genome | 3941 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
acacgccaac |
tRNA gene sequence |
GCGCCCGTAGCTCAACGGATAGAGCATCTGACTACGGATTAGAAGGTTGGGGGTTCGAAT |
Downstream region at tRNA end position |
cgtggaaagc |
Secondary structure (Cloverleaf model) | >WENV170784303 Arg ACG c ACCA cgtggaaagc G - C C - G G - C C - G C - G C - G G - C T A T C T C C C A C A A A | + | | | G G C T C G G G G G G C G | | | | T T A G A G C T A A AGGTT T - A C - G T - A G + T A - T C A T G A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |