Sequence ID | >WENV170784305 |
Genome ID | MCHG01000666 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 5844 |
End posion on genome | 5769 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
tttcattcct |
tRNA gene sequence |
AGGGTGGTGGCTCAATTGGTAGAGCAGCGGTCTCCAAAACCGCAGGTTGCAGGTTCGAGT |
Downstream region at tRNA end position |
gtcggtggta |
Secondary structure (Cloverleaf model) | >WENV170784305 Trp CCA t GCAA gtcggtggta A - T G - C G - C G - C T + G G - C G - C T G T T G T C C A T A A G + | | | | G T C T C G G C A G G C G | | | | T T G G A G C T A A AGGTT G - C C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |