Sequence ID | >WENV170784333 |
Genome ID | MCHG01000840 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 5033 |
End posion on genome | 5104 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
ctggatgtat |
tRNA gene sequence |
GTCAGAATGGCAGAGTGGCTATGCTTCCGGCTGCAACCCGGAATTATGTGAGTTCGATTC |
Downstream region at tRNA end position |
aaaaccgatt |
Secondary structure (Cloverleaf model) | >WENV170784333 Cys GCA t Ttgg aaaaccgatt G - C T - A C - G A - T G - C A - T A - T T T T C G C T C A G A G | + | | | G T G A C G G T G A G C G | | | T T G A T G C C T T ATTAT T - A C - G C - G G - C G - C C C T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |