Sequence ID | >WENV170784337 |
Genome ID | MCHG01000929 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 3031 |
End posion on genome | 3106 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
aacacaatcc |
tRNA gene sequence |
GGGTCCGTGGCGCAGCTGGTAGCGCACCTGCATGGCATGCAGGGGGTCAGGGGTTCGAAT |
Downstream region at tRNA end position |
agcacaacga |
Secondary structure (Cloverleaf model) | >WENV170784337 Ala GGC c ACCG agcacaacga G - C G - C G + T T - A C - G C - G G - C T A T T C C C C A C G A G | | | | | G T C G C G A G G G G C G | | | | T T G G C G C T A A GGGTC C - G C - G T - A G - C C - G A T T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |