Sequence ID | >WENV170784342 |
Genome ID | MCHG01000966 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 416 |
End posion on genome | 492 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
aatacattgc |
tRNA gene sequence |
GGCCTGGTAGTTCAGTTGGTTAGAATGCCAGCCTGTCACGCTGGAGGTCGACGGTTCGAA |
Downstream region at tRNA end position |
ttaaaaaaca |
Secondary structure (Cloverleaf model) | >WENV170784342 Asp GTC c GCCA ttaaaaaaca G - C G + T C - G C - G T - A G - C G - C C A T T T G C C A T G A A + | | | | G T C T T G G A C G G C G | | | + T T G G A A T T T A G AGGTC C - G C - G A - T G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |