Sequence ID | >WENV170784351 |
Genome ID | MCHG01000978 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 734 |
End posion on genome | 663 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
gagcaacagt |
tRNA gene sequence |
GCCTTGGTGGCTTAGGGGTATAGCGCGTCCTTGGTAAGGACGAGGTCGCGGGTTCAAATC |
Downstream region at tRNA end position |
tttgtttttt |
Secondary structure (Cloverleaf model) | >WENV170784351 Thr GGT t Ttaa tttgtttttt G - C C - G C - G T - A T + G G - C G - C T A T C G C C C A G A G | | | | | A G T T C G G C G G G C G | | | T T G T A G C T A G AGGTC C - G G - C T - A C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |