Sequence ID | >WENV170784415 |
Genome ID | MCHG01005128 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 1068 |
End posion on genome | 1143 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
ttttattcta |
tRNA gene sequence |
GCTGGTGTAGCTCAATTGGTAGAGCAGCTGACTTGTAATCAGCAGGTCGCGGGTTCGAGT |
Downstream region at tRNA end position |
tttaagaaat |
Secondary structure (Cloverleaf model) | >WENV170784415 Thr TGT a TCCA tttaagaaat G - C C - G T - A G - C G - C T - A G - C T G T T A C C C A T A A A + | | | G T C T C G G C G G G C G | | | | T T G G A G C T A A AGGTC G - C C - G T - A G - C A - T C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |