Sequence ID | >WENV170784420 |
Genome ID | MCHG01005473 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 649 |
End posion on genome | 574 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
cgttaaatgt |
tRNA gene sequence |
GGGGGTGTAGCTCAGCTGGGAGAGCACCTGCCTTGCAAGCAGGGGGTCAACGGTTCGATC |
Downstream region at tRNA end position |
aaacaaagct |
Secondary structure (Cloverleaf model) | >WENV170784420 Ala TGC t ACCA aaacaaagct G - C G - C G + T G - C G + T T - A G - C C T T T T G C C A C G A A | | | | | G T C T C G A A C G G C G | | | | T T G G A G C G A A GGGTC C - G C - G T - A G - C C - G C A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |