Sequence ID | >WENV170784426 |
Genome ID | MCHG01006337 |
Phylum/Class | [MCHG] permafrost metagenome; enrichment culture inoculated with soil; incubated with H2/CO2 at 20 degrees celsius and |
Species | |
Start position on genome | 85 |
End posion on genome | 156 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
aatacaattg |
tRNA gene sequence |
GGCCCTATGGTCAAGCGGTTAAGACACCGCCCTTTCACGGCGATAACCCGGGTTCGATTC |
Downstream region at tRNA end position |
aataggaaag |
Secondary structure (Cloverleaf model) | >WENV170784426 Glu TTC g Atta aataggaaag G - C G + T C - G C - G C - G T - A A - T T T T G G C C C A C G A G | | | | | G G A C T G C C G G G C G | | | T T T A G A C T A A TAAC C A C - G G - C C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |