| Sequence ID | >WENV170784734 |
| Genome ID | MCNG01000326 |
| Phylum/Class | [MCNG] bioreactor metagenome; sea sediment enriched with benzalkonium chloride |
| Species | |
| Start position on genome | 1961 |
| End posion on genome | 1888 |
| Amino Acid | Gly |
| Anticodon | CCC |
| Upstream region at tRNA start position |
agccgttcga |
| tRNA gene sequence |
GCGGGTGTCGTATAATGGCATTACTCCAGCTTCCCAAGCTGATAACGAGGGTTCGATTCC |
| Downstream region at tRNA end position |
cttccctcct |
| Secondary structure (Cloverleaf model) | >WENV170784734 Gly CCC
a TCCA cttccctcct
G - C
C - G
G - C
G - C
G - C
T - A
G - C T T
T T T C C C A
A A C + | | | | G
T T A T G G A G G G C
G | | | T T
G T T A C
C A T TAAC
C A
C - G
A - T
G - C
C - G
T A
T A
C C C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |