Sequence ID | >WENV170787682 |
Genome ID | MDSV01021747 |
Search identical group | |
Phylum/Class | [MDSV] marine metagenome; seawater |
Species | |
Start position on genome | 2469 |
End posion on genome | 2396 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
tttgtacgat |
tRNA gene sequence |
GGCACCGTGGCCGAGTGGCTAGGCAGAGCTCTGCAAAAGCTTGTACAGCGGTTCGAATCC |
Downstream region at tRNA end position |
gttttttacc |
Secondary structure (Cloverleaf model) | >WENV170787682 Cys GCA t TCTA gttttttacc G - C G - C C - G A - T C - G C - G G - C T A T T C G C C A G A G | | | | | G T G C C G A G C G G C G | | | T T G A G G C C T A GTAC G + T A - T G - C C - G T - A C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |