| Sequence ID | >WENV170788248 |
| Genome ID | MDSV01030462 |
| Phylum/Class | [MDSV] marine metagenome; seawater |
| Species | |
| Start position on genome | 246 |
| End posion on genome | 319 |
| Amino Acid | Gly |
| Anticodon | TCC |
| Upstream region at tRNA start position |
ctaccggggc |
| tRNA gene sequence |
GCGGGTATGGTGAAATGGTATCATAAGAGCCTTCCAAGCTTAAGGTGCGGGTTCGATTCC |
| Downstream region at tRNA end position |
gatatatcca |
| Secondary structure (Cloverleaf model) | >WENV170788248 Gly TCC
c TCCA gatatatcca
G - C
C - G
G - C
G - C
G - C
T - A
A - T T T
T C G C C C A
A A G | | | | | G
T A G T G G C G G G C
G | | | + T T
G T C A T
T A A AGGT
A A
G + T
A - T
G - C
C - G
C A
T A
T C C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |