| Sequence ID | >WENV170796774 |
| Genome ID | MDSV01169479 |
| Phylum/Class | [MDSV] marine metagenome; seawater |
| Species | |
| Start position on genome | 5 |
| End posion on genome | 79 |
| Amino Acid | Glu |
| Anticodon | TTC |
| Upstream region at tRNA start position |
nnnnnncaat |
| tRNA gene sequence |
GGTCCCTTCGTCTATCGGTTAGGACAGCTGGTTTTCATCCTGCAAAGGGGGGTTCGATTC |
| Downstream region at tRNA end position |
aatatggctt |
| Secondary structure (Cloverleaf model) | >WENV170796774 Glu TTC
t GCCA aatatggctt
G - C
G - C
T - A
C - G
C - G
C - G
T - A T T
T C C C C C A
C T A C | | | | | G
G T C T G G G G G G C
G + | | | T T
T G G A C
T A A AAAG
G - C
C - G
T T
G - C
G - C
T T
T A
T T C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |