Sequence ID | >W09103548 |
Genome ID | AAJH01000020 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Pelobacter propionicus DSM 2379 [AAJH] |
Start position on genome | 48388 |
End posion on genome | 48314 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
tttcggttac |
tRNA gene sequence |
AGGCGCGTAGCTCAGGGGGAGAGCGCTACCTTGACACGGTAGAGGTCGGCGGTTCGAGAC |
Downstream region at tRNA end position |
ttacagcagc |
Secondary structure (Cloverleaf model) | >W09103548 Val GAC c ACCA ttacagcagc A - T G - C G - C C - G G - C C - G G - C A G T C C G C C A G A A | | | | | G G C T C G G G C G G C G | | | | T T G G A G C G A G AGGTC C - G T - A A - T C - G C - G T C T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |