Sequence ID | >W141460116 |
Genome ID | JFFP01000034 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Vibrio parahaemolyticus CFSAN001595 [JFFP] |
Start position on genome | 11200 |
End posion on genome | 11125 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
aaactcaatg |
tRNA gene sequence |
GTGGCTATAGCTCAGTTGGTAGAGCCCCGGATTGTGATTCCGGTTGTCGCGAGTTCAAGT |
Downstream region at tRNA end position |
ttctttcctt |
Secondary structure (Cloverleaf model) | >W141460116 His GTG g CCCA ttctttcctt G - C T - A G - C G - C C - G T - A A - T T G T T G C T C A T G A A + | | | | A T C T C G G C G A G C G | | | | T T G G A G C T A C TTGTC C - G C - G G - C G - C A - T T T T A G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |