Sequence ID | >WENV170812467 |
Genome ID | MDSW01183970 |
Search identical group | |
Phylum/Class | [MDSW] marine metagenome; seawater |
Species | |
Start position on genome | 8400 |
End posion on genome | 8486 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
atgtttaaca |
tRNA gene sequence |
GCCCGGGTGGTGGAATTGGTAGACACAAGGGACTTAAAATCCCTCGCCAGAAATGGCGTG |
Downstream region at tRNA end position |
ccaataaaaa |
Secondary structure (Cloverleaf model) | >WENV170812467 Leu TAA a ACCA ccaataaaaa G + T C - G C - G C - G G - C G - C G + T T G T C G G C C A T A A G | | | | | A T G G T G G C C G G C G | | | T T G A C A C T A G A CGCCAGAAATGGCGT A - T G - C G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |