| Sequence ID | >WENV170823047 |
| Genome ID | MDSY01050850 |
| Phylum/Class | [MDSY] marine metagenome; seawater |
| Species | |
| Start position on genome | 3532 |
| End posion on genome | 3607 |
| Amino Acid | Thr |
| Anticodon | TGT |
| Upstream region at tRNA start position |
gaaaacaaat |
| tRNA gene sequence |
GCCCTTGTAGCTCAGCTGGTAGAGCAATTGATTTGTAATCAATAGGTCCGCGGTTCGACT |
| Downstream region at tRNA end position |
taaaatattc |
| Secondary structure (Cloverleaf model) | >WENV170823047 Thr TGT
t ACCA taaaatattc
G - C
C - G
C - G
C - G
T + G
T + G
G - C T C
T G T G C C A
C G A A | + | | | G
T C T C G C G C G G C
G | | | | T T
G G A G C
T A A AGGTC
A - T
T - A
T - A
G - C
A - T
T A
T A
T G T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |