Sequence ID | >WENV170824384 |
Genome ID | MDSY01074861 |
Search identical group | |
Phylum/Class | [MDSY] marine metagenome; seawater |
Species | |
Start position on genome | 7585 |
End posion on genome | 7502 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
cgtcacagat |
tRNA gene sequence |
GGTGGGGTTCCCGAGTGGCCAAAGGGAGCAGACTGTAAATCTGCCGCGAAAGCTTCGAAG |
Downstream region at tRNA end position |
gattcgctta |
Secondary structure (Cloverleaf model) | >WENV170824384 Tyr GTA t ACCA gattcgctta G - C G - C T - A G - C G - C G - C G - C T A T C T T C C A T G A T | | | | | G G G C C C G A A G G C G | | | T T C A G G G C A A A CGCGAAAGCTTC G - C C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |