Sequence ID | >WENV170824718 |
Genome ID | MDSY01080912 |
Search identical group | |
Phylum/Class | [MDSY] marine metagenome; seawater |
Species | |
Start position on genome | 25740 |
End posion on genome | 25811 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
agcttaagat |
tRNA gene sequence |
GCGGGTATAGCTCAGTGGTAGAGCGTCACCTTGCCAAGGTGAATGTCGCGCGTTCGAATC |
Downstream region at tRNA end position |
tcaaataaat |
Secondary structure (Cloverleaf model) | >WENV170824718 Gly GCC t Ttat tcaaataaat G - C C - G G - C G - C G - C T - A A - T T A T T G C G C A G A A + | | | | G T C T C G G C G C G C G | | | | T T G G A G C T A G ATGTC T - A C - G A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |