Sequence ID | >WENV170828125 |
Genome ID | MDSY01143531 |
Search identical group | |
Phylum/Class | [MDSY] marine metagenome; seawater |
Species | |
Start position on genome | 2385 |
End posion on genome | 2467 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
atagaaaaaa |
tRNA gene sequence |
GCGGACGTGGCGAAATTGGTAGACGCACTAGATTTAGGTTCTAGCGAGCACCCCTCATGA |
Downstream region at tRNA end position |
aaaataaagt |
Secondary structure (Cloverleaf model) | >WENV170828125 Leu TAG a Atta aaaataaagt G - C C - G G - C G - C A - T C - G G - C T G T C T C T C A T A A G | | | | | G T A G C G G A G A G C G | | | T T G A C G C T A G A CGAGCACCCCTCAT C - G T - A A - T G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |