| Sequence ID | >WENV170829542 |
| Genome ID | MDSZ01010660 |
| Phylum/Class | [MDSZ] marine metagenome; seawater |
| Species | |
| Start position on genome | 3215 |
| End posion on genome | 3141 |
| Amino Acid | Gly |
| Anticodon | GCC |
| Upstream region at tRNA start position |
ctccatatat |
| tRNA gene sequence |
GCGGAAGTAGCTCAGCGGTAGAGCCCCACGTTGCCAACGTGGATGTCGCGGGTTCAAATC |
| Downstream region at tRNA end position |
tttacaaatg |
| Secondary structure (Cloverleaf model) | >WENV170829542 Gly GCC
t TCCA tttacaaatg
G - C
C - G
G - C
G - C
A - T
A - T
G - C T A
T T G C C C A
G A A + | | | | A
C C T C G G C G G G C
G | | | | T T
G G A G C
T A C ATGTC
C - G
C - G
A - T
C - G
G - C
T A
T A
G C C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |