Sequence ID | >WENV170831160 |
Genome ID | MDSZ01039526 |
Search identical group | |
Phylum/Class | [MDSZ] marine metagenome; seawater |
Species | |
Start position on genome | 7080 |
End posion on genome | 7153 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
tactaggtag |
tRNA gene sequence |
CGGGGCGTGGCGCAGCTTGGTAGCGCGGGTGCTTTGGGAGCACTAGGTCGCAGGTTCGAA |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170831160 Pro TGG g Atcn nnnnnnnnnn C - G G - C G - C G - C G - C C - G G - C T A T T G T C C A C G A G + | | | | G T C G C G G C A G G C T | | | | T T G G C G C G T A G AGGTC G + T G - C T - A G - C C - G T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |