Sequence ID | >WENV170831346 |
Genome ID | MDSZ01042425 |
Search identical group | |
Phylum/Class | [MDSZ] marine metagenome; seawater |
Species | |
Start position on genome | 14 |
End posion on genome | 89 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
agctctatat |
tRNA gene sequence |
AGGAGTGTAGCTCAATTGGTAGAGCGCCGGTCTCCAAAACCGGAGGCTGAGGGTTCGAGT |
Downstream region at tRNA end position |
attaagttaa |
Secondary structure (Cloverleaf model) | >WENV170831346 Trp CCA t GCCA attaagttaa A - T G - C G - C A - T G - C T + G G - C T G T C T C C C A T A A A | | | | | G T C T C G G A G G G C G | | | | T T G G A G C T A G AGGCT C - G C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |