Sequence ID | >WENV170833727 |
Genome ID | MDSZ01084820 |
Search identical group | |
Phylum/Class | [MDSZ] marine metagenome; seawater |
Species | |
Start position on genome | 350 |
End posion on genome | 425 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
gccctcctgc |
tRNA gene sequence |
AGGGGTGTAGCTCAGCTGGTAGAGCATCGGTCTCCAAAACCGAGGGCCACGGGTTCGAAT |
Downstream region at tRNA end position |
tttccttttt |
Secondary structure (Cloverleaf model) | >WENV170833727 Trp CCA c GCCA tttccttttt A - T G - C G - C G - C G - C T - A G - C T A T T G T C C A C G A A | | + | | G T C T C G A C G G G C G | | | | T T G G A G C T A A GGGCC T - A C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |