| Sequence ID | >WENV170842005 |
| Genome ID | MDSZ01232043 |
| Phylum/Class | [MDSZ] marine metagenome; seawater |
| Species | |
| Start position on genome | 2318 |
| End posion on genome | 2245 |
| Amino Acid | Arg |
| Anticodon | ACG |
| Upstream region at tRNA start position |
tttcacccaa |
| tRNA gene sequence |
GCGCTTGTAGCTCAGCGGATTAGAGCATCTGACTACGGATCAGAGGGTCGGGAGTTCGAA |
| Downstream region at tRNA end position |
atgaactgcc |
| Secondary structure (Cloverleaf model) | >WENV170842005 Arg ACG
a Gttg atgaactgcc
G - C
C - G
G - C
C - G
T + G
T - A
G - C T A
T C T C T C A
C G A A | + | | | G
G C T C G G G G A G C
G | | | | T T
A G A G C
T T A A GGGTC
T - A
C - G
T - A
G - C
A - T
C A
T G
A C G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |