Sequence ID | >WENV170855367 |
Genome ID | MDTA01204605 |
Search identical group | |
Phylum/Class | [MDTA] marine metagenome; seawater |
Species | |
Start position on genome | 2345 |
End posion on genome | 2272 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
tagattttaT |
tRNA gene sequence |
GCCGGCTTAGCTCAGCGGTAGAGCAGCGCTTTTGTAAAGCGAAGGCCATCAGTTCAAATC |
Downstream region at tRNA end position |
tattaacagt |
Secondary structure (Cloverleaf model) | >WENV170855367 Thr TGT T ATac tattaacagt G - C C - G C - G G - C G - C C - G T - A T A T T T G T C A G A A | | | | A C C T C G A T C A G C G | | | | T T G G A G C T A A AGGCC G A C - G G - C C - G T - A T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |