| Sequence ID | >WENV170858871 |
| Genome ID | MDTB01028423 |
| Phylum/Class | [MDTB] marine metagenome; seawater |
| Species | |
| Start position on genome | 3084 |
| End posion on genome | 3160 |
| Amino Acid | Arg |
| Anticodon | ACG |
| Upstream region at tRNA start position |
aaataaaatt |
| tRNA gene sequence |
GCGCCTGTAGCTCAACTGGATAGAGCGCTTGGCTACGGACCAGGAGGTTCTGGGTTCAAA |
| Downstream region at tRNA end position |
tgaatattat |
| Secondary structure (Cloverleaf model) | >WENV170858871 Arg ACG
t ACCA tgaatattat
G - C
C - G
G - C
C - G
C - G
T - A
G - C T A
T G A T C C A
C A A A | | + | | A
T C T C G C T G G G C
G | | | | T T
G G A G C
A T A G AGGTT
C - G
T + G
T - A
G - C
G - C
C A
T G
A C G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |