Sequence ID | >WENV170862311 |
Genome ID | MDTB01076062 |
Search identical group | |
Phylum/Class | [MDTB] marine metagenome; seawater |
Species | |
Start position on genome | 73 |
End posion on genome | 145 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
caggcgacac |
tRNA gene sequence |
GCCGGGATAGCTCAGTTGGTAGAGCAGGCGACTGAAAATCGCCGTGTCCCCAGTTCAAAT |
Downstream region at tRNA end position |
caccgatgcc |
Secondary structure (Cloverleaf model) | >WENV170862311 Phe GAA c Atct caccgatgcc G - C C - G C - G G + T G - C G - C A - T T A T G G G T C A T G A A | | | | | A T C T C G C C C A G C G | | | | T T G G A G C T A A GTGTC G - C G - C C - G G - C A - T C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |