Sequence ID | >W141465678 |
Genome ID | JFMQ01000068 |
Search identical group | |
Phylum/Class | Cyanobacteriota |
Species | Prochlorococcus sp. scB243_498G3 [JFMQ] |
Start position on genome | 17243 |
End posion on genome | 17169 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
aattcccttT |
tRNA gene sequence |
GGGGGTGTAGCAATCTGGTGAATGCACCAAACTCATAATTTGGCTAAGGCGAGTTCGATC |
Downstream region at tRNA end position |
ttcatttgtc |
Secondary structure (Cloverleaf model) | >W141465678 Met CAT T ATta ttcatttgtc G - C G - C G - C G - C G - C T - A G - C C T T C G C T C A T C T A | | | | | G G A A C G G C G A G C G | | | T T T A T G C G A A CTAAG C - G C - G A - T A - T A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |