Sequence ID | >W141465888 |
Genome ID | JFMZ01000059 |
Search identical group | |
Phylum/Class | Cyanobacteriota |
Species | Prochlorococcus sp. scB245a_518A17 [JFMZ] |
Start position on genome | 3590 |
End posion on genome | 3517 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
agtaaagtta |
tRNA gene sequence |
CGGGGCGTAGCGCAGTTTGGTAGCGCACCACTTTGGGGTAGTGGGGGTCGTGGGTTCAAA |
Downstream region at tRNA end position |
cttatcgtct |
Secondary structure (Cloverleaf model) | >W141465888 Pro GGG a Atta cttatcgtct C - G G - C G - C G + T G + T C - G G - C T A T C G C C C A T G A A | + | | | A T C G C G G T G G G C T | | | | T T G G C G C G T A A GGGTC C - G C - G A - T C - G T - A T T T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |