Sequence ID | >WENV170869991 |
Genome ID | MDTB01184752 |
Search identical group | |
Phylum/Class | [MDTB] marine metagenome; seawater |
Species | |
Start position on genome | 1401 |
End posion on genome | 1325 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
ccttaccaaa |
tRNA gene sequence |
GGCCCCGTGGCTCAACTGGATAGAGCAGCCCCCTCCTAAGGGGCAGGTTGCAGGTTCGAA |
Downstream region at tRNA end position |
acaagtatgt |
Secondary structure (Cloverleaf model) | >WENV170869991 Arg CCT a GCCA acaagtatgt G - C G + T C - G C - G C - G C - G G - C T A T C G T C C A C A A G | | | | | G T C T C G G C A G G C G | | | | T T G G A G C A T A A AGGTT G - C C - G C - G C - G C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |