Sequence ID | >WENV170870923 |
Genome ID | MDTB01199340 |
Search identical group | |
Phylum/Class | [MDTB] marine metagenome; seawater |
Species | |
Start position on genome | 658 |
End posion on genome | 734 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
gtatcttagt |
tRNA gene sequence |
GCCGATGTAGCTCAGTTGGTTAGAGCACTAGATTGTGGATCTAGGGGTCCCCCGTTCGAG |
Downstream region at tRNA end position |
aaattcgata |
Secondary structure (Cloverleaf model) | >WENV170870923 His GTG t ACCA aaattcgata G + T C - G C - G G - C A - T T - A G - C C G T G G G G C A T G A A | | | | | G T C T C G C C C C G C G | | | | T T G G A G C T T A A GGGTC C - G T - A A - T G - C A - T T A T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |