Sequence ID | >WENV170874672 |
Genome ID | MDTC01009124 |
Search identical group | |
Phylum/Class | [MDTC] marine metagenome; seawater |
Species | |
Start position on genome | 1103 |
End posion on genome | 1178 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
taggtgtccc |
tRNA gene sequence |
GCCCCGTTCGTCTAGCGGCCTAGGACGCTGGCCTTTCACGCCGGTAACACGGGTTCAAAT |
Downstream region at tRNA end position |
atacacttca |
Secondary structure (Cloverleaf model) | >WENV170874672 Glu TTC c ACAA atacacttca G + T C - G C - G C - G C - G G - C T - A T A T T G C C C A C G A C | | | | | A G T C T G A C G G G C G + | | | T T C G G A C C T A G TAAC C - G T + G G - C G - C C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |