Sequence ID | >WENV170881053 |
Genome ID | MDTC01124709 |
Search identical group | |
Phylum/Class | [MDTC] marine metagenome; seawater |
Species | |
Start position on genome | 461 |
End posion on genome | 535 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
aaagaagaac |
tRNA gene sequence |
GCCACTCTAGCTCAGCTGGATAGAGCAACGGTTTTGTAAACCGTAGGTCAACGGTTCAAG |
Downstream region at tRNA end position |
tggggaatta |
Secondary structure (Cloverleaf model) | >WENV170881053 Thr TGT c TCtc tggggaatta G - C C - G C - G A - T C - G T - A C - G T G T T T G C C A C G A A | | | | | A T C T C G A A C G G C G | | | | T T G G A G C A T A A AGGTC A - T C - G G - C G - C T - A T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |